Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.060076 |
Chromosome: | chromosome 9 |
Location: | 2009883 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396750 | CSE18 | Predicted protein of CSE family; (1 of 1) IPR000601//IPR022409 - PKD domain // PKD/Chitinase domain | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGTATGAAGTACAAACCCGGCAGCCGCTCAGAGCGGCCTCAGCACATT |
Internal bar code: | GGCGTTGTCAAGAGCCATGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2740 |
LEAP-Seq percent confirming: | 98.5916 |
LEAP-Seq n confirming: | 70 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGAGCCGCATTGACATTCG |
Suggested primer 2: | ACCGTACTGACACCAGCTTG |