| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.060172 |
| Chromosome: | chromosome 6 |
| Location: | 6357395 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g293150 | PGM12 | (1 of 2) PTHR23029:SF12 - PHOSPHOMUTASE PMU1-RELATED; Phosphoglycerate mutase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGACGTCTACCAAACGAAGCCATATTAAGGAATTCGGCCACTGACGCC |
| Internal bar code: | AGGGCCTTCGATGATCGCGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4910 |
| LEAP-Seq percent confirming: | 11.0 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 89 |
| LEAP-Seq n unique pos: | 100 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGCGTCATATTACGGGAA |
| Suggested primer 2: | AGCGCTCGTATCTTCCTTCG |