| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.060189 |
| Chromosome: | chromosome 12 |
| Location: | 2571850 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g506700 | SMM41 | (1 of 14) PF10294 - Lysine methyltransferase (Methyltransf_16); S-adenosyl-L-methionine-dependent methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGACTACACCATCGCCGGCTCCACCGGCTTCCTGTTGTGGGAGGCCAA |
| Internal bar code: | TCTCAATCCCCGATTGATTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 226 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCACCCTGTACTCACCAC |
| Suggested primer 2: | TCTTCTGTTCGCACCACCTC |