| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.060227 |
| Chromosome: | chromosome 9 |
| Location: | 5010434 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g405600 | SFT1 | (1 of 1) K08505 - protein transport protein SFT1 (SFT1); Intra-Golgi Qc-SNARE protein, Gs15/Sft1 family (Qc.II) | 5'UTR |
| Cre09.g405650 | (1 of 1) PTHR12794:SF0 - GEM-ASSOCIATED PROTEIN 2 | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAGCGAATCGCTAGGGGCGGAGACGCCGAGTCACAGCTGCCCATCCCA |
| Internal bar code: | ATCACGTGGGAGAGCGTGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2120 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTAGTTTGGGCCAACGGAC |
| Suggested primer 2: | GAACTGGATGGTTGAGGGGG |