Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.060235 |
Chromosome: | chromosome 12 |
Location: | 3444419 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g497450 | FAP412 | (1 of 21) IPR001611//IPR003591 - Leucine-rich repeat // Leucine-rich repeat, typical subtype; Flagellar Associated Protein 412 | CDS |
Cre12.g497500 | SNE7 | (1 of 8) PTHR10366:SF411 - HIGH CHLOROPHYLL FLUORESCENCE PHENOTYPE 173 PROTEIN; Cinnamoyl-CoA reductase/flavanone 4-reductase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCTCCCAGGGCGGCCGCTCCACATGCAGCTGCAGGCGTGCCTCCATG |
Internal bar code: | GCTTTCGAAACATAGGGCTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1195 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCAAGGTGGAATACGACA |
Suggested primer 2: | GCTGTGGGAATGGGAATGGA |