Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.060261 |
Chromosome: | chromosome 2 |
Location: | 7462228 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g800263 | 3'UTR | ||
Cre09.g392393 | (1 of 781) IPR000104 - Antifreeze protein, type I | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCCTTAGTGACGCCCACACCACGGAAGTCAGCAATCTCGCCGTTGCC |
Internal bar code: | TTGCTTTTCGAGATATGTTTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3164 |
LEAP-Seq percent confirming: | 11.4754 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 54 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCATTCAGGCCTGTTACCGT |
Suggested primer 2: | CCACAACCTCCTCGTCACTC |