| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.060271 |
| Chromosome: | chromosome 5 |
| Location: | 1559588 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234666 | (1 of 6) 2.7.7.84 - 2'-5' oligoadenylate synthase | 3'UTR | |
| Cre05.g800535 | (1 of 25) IPR001965//IPR011011//IPR013083//IPR019787 - Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, PHD-finger | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTATTGTCTTGTCTGCACGCTAATGATAAAGAGGAAATGCAAAGACCG |
| Internal bar code: | TCTTCCCGAAATGAGATAGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4159 |
| LEAP-Seq percent confirming: | 12.2807 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTTGTCGGGTGAGGTTTA |
| Suggested primer 2: | AGATTTTCTCGGGCGCTTGA |