Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.060302 |
Chromosome: | chromosome 11 |
Location: | 3112767 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g475350 | (1 of 1) PF05093 - Cytokine-induced anti-apoptosis inhibitor 1, Fe-S biogenesis (CIAPIN1) | 3'UTR | |
Cre11.g475400 | (1 of 1) K11864 - BRCA1/BRCA2-containing complex subunit 3 (BRCC3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACATTGTTCCCCAAACCCTGAGTTCACTTTGACAGCTGCACAGTATC |
Internal bar code: | ATATGTTAAGATATGGAGTAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4200 |
LEAP-Seq percent confirming: | 78.7879 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCATTCCCAACAGCTACCT |
Suggested primer 2: | CACATTCTTAGCACGCTCGC |