| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.060351 |
| Chromosome: | chromosome 2 |
| Location: | 4378111 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105450 | CGL141 | (1 of 1) PTHR36749:SF1 - F7O18.3 PROTEIN; Conserved in the Green Lineage | 3'UTR |
| Cre02.g105500 | AOD1 | Acetylornithine deacetylase; (1 of 1) 3.5.1.16 - Acetylornithine deacetylase / N-acetylornithinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGAGTGTGGGACCCTCTCTGGACCTATTTAGGACTGACCCACATGACA |
| Internal bar code: | GGGAGTTCGCTAACGGATAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1154 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACAAGGAGCAGAACAGGT |
| Suggested primer 2: | GAACTGGGCTCCATTGTGGA |