| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.060388 |
| Chromosome: | chromosome 12 |
| Location: | 7066957 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g560200 | NAT2 | Glucosamine 6-phosphate N-acetyltransferase; (1 of 1) 2.3.1.4 - Glucosamine-phosphate N-acetyltransferase / Phosphoglucosamine transacetylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTTCCCGAGCCCAACGGCCAGGTCCCATCGCCAAAAGCCATCCGAGCG |
| Internal bar code: | GGAGCATTTCTATACACGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 259 |
| LEAP-Seq percent confirming: | 28.5714 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGGTGGTGGAGCTCAAGT |
| Suggested primer 2: | CCGCAGTGTTGACAAACAGG |