Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.060394 |
Chromosome: | chromosome 1 |
Location: | 4583815 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g031550 | CSB6 | (1 of 12) IPR004843//IPR029052 - Calcineurin-like phosphoesterase domain, apaH type // Metallo-dependent phosphatase-like; Probable transposon-derived protein of Chlamydomonas-Specific family B | 5'UTR |
Cre01.g031600 | (1 of 2) PF05915 - Eukaryotic protein of unknown function (DUF872) (DUF872) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTTTATCAGCAATGTTTTTATTGGAGTAGTCGATCTATACTGTAAGTG |
Internal bar code: | TAGGCCCGATCAAGAGTGCTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5138 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 97 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 97 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATCGAAACAGCCCTGCTCA |
Suggested primer 2: | CCTAGAGGCTACCCACCCTT |