| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.060409 |
| Chromosome: | chromosome 9 |
| Location: | 916532 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403150 | PWR9 | (1 of 14) PF04720 - PDDEXK-like family of unknown function (PDDEXK_6); PWR motif protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGGCTTGACTATCCCGCCCACTGTCTTTCATGGACGGCGGATGGGCC |
| Internal bar code: | TAGGACTGAGGTTAGAGACTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4458 |
| LEAP-Seq percent confirming: | 47.2973 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCGATTCTGGATACGACG |
| Suggested primer 2: | AGTTTGCACTCGTTTGCGTC |