Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.060422 |
Chromosome: | chromosome 6 |
Location: | 8743148 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g310700 | RPL36A,RPL36a,RPL41 | Ribosomal protein L36a; (1 of 1) K02929 - large subunit ribosomal protein L44e (RP-L44e, RPL44) | 3'UTR |
Cre06.g310750 | COPG1 | (1 of 1) K17267 - coatomer protein complex, subunit gamma (COPG); Gamma subunit of COP-I complex | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTAAGTGATTACTCCCCTGCTACAATCCCAGTGGCGTGTTGGTGAGAC |
Internal bar code: | TGTGCCGATCACCTCTGTACTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4395 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 64 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCGTGTATGAGACCGGGG |
Suggested primer 2: | CCCATGAGTCGTGTGTCACA |