| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.060436 |
| Chromosome: | chromosome 1 |
| Location: | 1038246 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g006150 | EFG9,PRFC1, PRFC1,PRF3 | (1 of 1) PTHR23115//PTHR23115:SF69 - TRANSLATION FACTOR // PEPTIDE CHAIN RELEASE FACTOR 3; Putative chloroplast translation peptide-chain release factor 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTTGCTCGCCCAGCCCCAGCCGCCCACTCACCCGACACCACGCGCACG |
| Internal bar code: | ATAATCCCAGGCTACATCACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 105 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGGATTGGGTGGCGGAAT |
| Suggested primer 2: | AGGCAGGGAAGGAGAAATGC |