| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.060442 |
| Chromosome: | chromosome 15 |
| Location: | 1521582 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g801738 | (1 of 1) PTHR14387:SF0 - PROTEIN Y92H12A.5, ISOFORM B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATACCGTTAAATGGTGGTTGGGTTGCGGTTAGCGGTTAGCGGTTGGCG |
| Internal bar code: | TGCGAGTGGGAGGTTTGCCACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 63.6364 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGTGATCCTCTCCCCCTC |
| Suggested primer 2: | CCCCACCCCATACAGGTTTC |