| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.060454 |
| Chromosome: | plastome |
| Location: | 69900 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802282 | psaA_exon3,ChreCp019,2717000 | photosystem I P700 apoprotein A1 transpliced exon 3 of 3; (1 of 1) K02689 - photosystem I P700 chlorophyll a apoprotein A1 (psaA) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCTACGTGGTGGTGAGCAGTATCACTTAACCAAAGACCACCAGTAACA |
| Internal bar code: | GGTAGCCATATTGCTTGAGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 204 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGTTGGTTCCACTACCA |
| Suggested primer 2: | CAGGACCGTCACAAGGGAAA |