| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.060457 |
| Chromosome: | chromosome 10 |
| Location: | 916287 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424150 | TF2A4 | (1 of 1) K03123 - transcription initiation factor TFIIA small subunit (TFIIA2, GTF2A2, TOA2); Transcription initiation factor IIA, gamma subunit | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAAATAAAAATTGACAAGGTCAGGGGTGTCGACCAGAGCTAGAGAACA |
| Internal bar code: | CTGCTATTAGATTAGGAACCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3323 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGACATGGACTGTGACGG |
| Suggested primer 2: | GCTGTTTGATAGAGCTGCGC |