| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.060475 |
| Chromosome: | plastome |
| Location: | 175327 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802329 | ChreCp064,psbD,2716961 | (1 of 1) K02706 - photosystem II P680 reaction center D2 protein (psbD); photosystem II protein D2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAAGTAACGAAAGTAGTACCAGTTAACCAACCACCTAATGCAAAGTAA |
| Internal bar code: | TTAGAAGTTCGCGTAGTCAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 270 |
| LEAP-Seq percent confirming: | 69.5652 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGGGATAGGCCAGGCAAT |
| Suggested primer 2: | ACGGAATGTGTTAGCACCGT |