Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.060504 |
Chromosome: | chromosome 13 |
Location: | 4019294 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g590550 | COA5,COAD1 | (1 of 1) 2.7.7.3 - Pantetheine-phosphate adenylyltransferase / PPAT; Pantetheine-phosphate adenylyltransferase, CoA biosynthesis | 5'UTR |
Cre13.g590600 | PDE32 | (1 of 1) IPR000104//IPR002073//IPR023088 - Antifreeze protein, type I // 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain // 3'5'-cyclic nucleotide phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAAAAGGCCCAAGCGCGAGAGGGGTGGCTGGTCCCGGGCTTGGCGGTT |
Internal bar code: | GTTGTAGGAGGTTGGAGAGAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 194 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCTGTGGTGGGAGGGAAAG |
Suggested primer 2: | CGCCCCTGTCGTTTTGAAAG |