Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.060514 |
Chromosome: | chromosome 1 |
Location: | 2999308 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g018800 | ATP6 | Mitochondrial F1F0 ATP synthase subunit 6; (1 of 1) PTHR11410//PTHR11410:SF0 - ATP SYNTHASE SUBUNIT A // ATP SYNTHASE SUBUNIT A | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAAGCCAGCATGGCAAGGGTGCACGCTGGCCGGGTGCGCGCCACAGGT |
Internal bar code: | TATATTATGGCTGCTCTTGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2879 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAATCCCCGGGTGCTTCAAC |
Suggested primer 2: | AGTGATAGGAGAGGTGCGGT |