Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.060566 |
Chromosome: | chromosome 10 |
Location: | 94016 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g418150 | FAP178 | (1 of 1) IPR001715//IPR010441 - Calponin homology domain // CH-like domain in sperm protein; Flagellar Associated Protein 178 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAAATGCCTAGTTTGTAGCGTTTGGGGGGGAAGGGCGCAGCCGCTGCT |
Internal bar code: | TATCCAATCCGCTCCAAACTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 114 |
LEAP-Seq percent confirming: | 1.20482 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 82 |
LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGCAAACTCAACACATGGT |
Suggested primer 2: | TAGACGATGGTGGCGTATGC |