| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.060618 |
| Chromosome: | chromosome 3 |
| Location: | 5769963 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g187500 | (1 of 1) PTHR23339:SF64 - CYCLIN-DEPENDENT KINASE INHIBITOR 3; Dual specificity phosphatase | outside_mRNA | |
| Cre03.g187550 | (1 of 1) PF04858 - TH1 protein (TH1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTACCATCTTCTCTTCCACCAACGGGCCGACGATACTCCACTTTCCAC |
| Internal bar code: | GATTGACAGACATATCGGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2296 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACGACTGTGTGTGGCAG |
| Suggested primer 2: | AAGAAGCTTTGCCGCACAAG |