Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.060622 |
Chromosome: | chromosome 17 |
Location: | 4523359 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g731466 | (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | gene_edge/mRNA_edge/3'UTR | |
Cre17.g731500 | FAP394 | Flagellar Associated Protein 394; (1 of 1) IPR000157//IPR011050 - Toll/interleukin-1 receptor homology (TIR) domain // Pectin lyase fold/virulence factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATTACATCTCAACAGCTCGCCTCCGATCCTCTGTCACTACGTGCGACC |
Internal bar code: | TTACGGCATATGTTGTATTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 638 |
LEAP-Seq percent confirming: | 94.7368 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACTCACGCAACCCCTAAT |
Suggested primer 2: | CTTCAACACCAACGTGCAGG |