| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.060626 |
| Chromosome: | chromosome 6 |
| Location: | 204095 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g250350 | (1 of 1) PF05216 - UNC-50 family (UNC-50) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTCGGAGCATCCTTGGGGGGCAGCCCGTAACAGCCCAGGAAGCAGAGG |
| Internal bar code: | CGTACGGGAATAGACACTCTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 110 |
| LEAP-Seq percent confirming: | 2.43902 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 80 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTTCTGTGTCGAGTCCA |
| Suggested primer 2: | TCCCATGGAGTGAGGGCATA |