| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.060662 |
| Chromosome: | chromosome 12 |
| Location: | 4190260 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g517850 | (1 of 18) PF12906 - RING-variant domain (RINGv) | 3'UTR | |
| Cre12.g517900 | SCA1,SECA1 | (1 of 1) K03070 - preprotein translocase subunit SecA (secA); Chloroplast-associated SecA protein | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATAGCGGAAGCCTCGCCTCATGCCCGCCAACACCCCATCATACAGCAT |
| Internal bar code: | GTTCGAATTCGACCCACCGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2155 |
| LEAP-Seq percent confirming: | 88.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAACGCTTCATGTTCCGC |
| Suggested primer 2: | GTGTGTGTGTGTGTGTACGC |