Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.060679 |
Chromosome: | chromosome 2 |
Location: | 1158669 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g081150 | TET3 | (1 of 12) PF12851 - Oxygenase domain of the 2OGFeDO superfamily (Tet_JBP); non-canonical TET-dioxygenase, putative 5-methylcytosine-modifying enzyme | 3'UTR |
Cre02.g081176 | (1 of 6) IPR001537//IPR029028 - tRNA/rRNA methyltransferase, SpoU type // Alpha/beta knot methyltransferases | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGCCACAAACATCAGCCACAAACAATGCCTCGGAAACAACACCTCGGA |
Internal bar code: | TAAGACATCTCAGGTGGACAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1600 |
LEAP-Seq percent confirming: | 77.5862 |
LEAP-Seq n confirming: | 45 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACGAAACGTGTGTCGCTCA |
Suggested primer 2: | CCACTTCCTTCGCTACCAGG |