Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.060696 |
Chromosome: | chromosome 3 |
Location: | 3166966 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g164950 | SRS3 | Serine/arginine-rich pre-mRNA splicing factor; (1 of 5) IPR000504//IPR012677 - RNA recognition motif domain // Nucleotide-binding alpha-beta plait domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCAGCAGCCCGCAACCAACCACCACCGCGCCGTAACGCCGCGCTCAC |
Internal bar code: | GGCCATATTGCGCTTGTCGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1963 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAGTAACTTCGTGCCCCAC |
Suggested primer 2: | AGTCTGGGGTCATAGGGGAC |