Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.060748 |
Chromosome: | chromosome 3 |
Location: | 1229618 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g149650 | CCD1 | related to carotenoid 9%252C10-9'%252C10' cleavage dioxygenase; (1 of 1) K11159 - carotenoid cleavage dioxygenase (K11159) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCCCCCGACGACTGCGGAATCGGCACGCGTTAGGCATCATGCCCTGTT |
Internal bar code: | ATTACTTGATTCAGGTTCACTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2518 |
LEAP-Seq percent confirming: | 96.6667 |
LEAP-Seq n confirming: | 29 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATTCGTGGGGTTCCTGTGC |
Suggested primer 2: | CATCGCATGCGCCCAATTTA |