| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.060753 |
| Chromosome: | chromosome 6 |
| Location: | 7382518 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300100 | PIA1,PIG-L | (1 of 1) 3.5.1.89 - N-acetylglucosaminylphosphatidylinositol deacetylase / N-acetylglucosaminylphosphatidylinositol de-N-acetylase; N-acetylglucosaminylphosphatidylinositol de-N-acetylase family protein | 3'UTR |
| Cre06.g300139 | (1 of 7) IPR010995 - DNA repair Rad51/transcription factor NusA, alpha-helical | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTGTGAGAACCTGGCAAGGGGCACAACCCAAAATAGCTTTGGTTCTC |
| Internal bar code: | GGACAAGCACCTAAACTCCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2170 |
| LEAP-Seq percent confirming: | 96.5517 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTATGTGCGCCTGTGATGT |
| Suggested primer 2: | TGCTACGGGTGAGGACCATA |