| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.060822 |
| Chromosome: | mitogenome |
| Location: | 10636 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreMt.g802343 | ChrepMp07,nad1,801499 | NADH dehydrogenase subunit 1; (1 of 1) K03878 - NADH-ubiquinone oxidoreductase chain 1 (ND1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCATCGGAAATGCAAATGCCAACCCAAGCGACTTGGCTTAGTACAAA |
| Internal bar code: | TGCGTTAAGGGCAGATTAGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 75 |
| LEAP-Seq percent confirming: | 2.77778 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGGGCCACGGTTCTTATG |
| Suggested primer 2: | CGCGAGTCCATACAAAAGCG |