Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.060847 |
Chromosome: | chromosome 2 |
Location: | 7981445 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g145100 | FAP39 | Flagellar Associated Protein 39; (1 of 1) PF00122//PF00689//PF00690//PF00702//PF12710 - E1-E2 ATPase (E1-E2_ATPase) // Cation transporting ATPase, C-terminus (Cation_ATPase_C) // Cation transporter/ATPase, N-terminus (Cation_ATPase_N) // haloacid dehalogenase-like hydrolase (Hydrolase) // haloacid dehalogenase-like hydrolase (HAD) | 3'UTR |
Cre02.g145133 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGATTAAAAGTGGGACAGCAGATGTTGATTAACAGTGCCCGTATTTTGT |
Internal bar code: | CGGCGTGTCGATTATGTAATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5172 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 95 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 95 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGACAGGGACCCGTTTACG |
Suggested primer 2: | TTGGGGTGGTGGTTCGTATG |