Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.060867 |
Chromosome: | chromosome 17 |
Location: | 1649200 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g707800 | SNRK2J | (1 of 4) PTHR24343//PTHR24343:SF167 - SERINE/THREONINE KINASE // SUBFAMILY NOT NAMED; snRK1 family in Chlamydomonas, subgroup 2 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTGCGCATCTTAGGCAGGCACAGTCCGCGCTTTCGGAGCACAACGCTC |
Internal bar code: | TAAGTAAACACCCTTGCCACTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 380 |
LEAP-Seq percent confirming: | 1.81818 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 54 |
LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATGAACGCGAATGGACACG |
Suggested primer 2: | GTGTCACCAGGTCCCTCTTG |