| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.060913 |
| Chromosome: | chromosome 1 |
| Location: | 7049688 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g050451 | TTL6 | (1 of 1) 1.2.1.24//6.3.2.25 - Succinate-semialdehyde dehydrogenase (NAD(+)) // Tubulin--tyrosine ligase / TTL; predicted tubulin tyrosine ligase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAGCCCCCTTTCTTCATGTTGCTGCCCGCCCCGGGAGTATTAACGAAC |
| Internal bar code: | GGGTGGATGAGGCGGTATGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 113 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGTCCCACATGTCGTTC |
| Suggested primer 2: | CCGCTACTGACGATCCACTC |