Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.060925 |
Chromosome: | chromosome 8 |
Location: | 579778 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g359850 | FBB11 | Flagellar and Basal Body Protein 11; (1 of 2) PF13864 - Calmodulin-binding (Enkurin) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACCCGCATTCCCACGGCCCCCCGACACTTGTACTGCAGCAACACAAT |
Internal bar code: | TTGTTAATCACTATAAAACTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4102 |
LEAP-Seq percent confirming: | 99.2 |
LEAP-Seq n confirming: | 124 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 125 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACCTCACTCCCGTCAGTC |
Suggested primer 2: | TGACTTGCGTGTGCTGGTAT |