| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.060931 |
| Chromosome: | chromosome 16 |
| Location: | 7582406 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684155 | (1 of 1) K11271 - sister chromatid cohesion protein DCC1 (DSCC1, DCC1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCCGCGCCATCCAGGTGCCGGGCCAGTCGGCCGAGGCAGTGCTGCTGC |
| Internal bar code: | GTGCTCCGTATGATTATCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 997 |
| LEAP-Seq percent confirming: | 18.1818 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGGTCTAGGCAGGCATGA |
| Suggested primer 2: | TCCATTTTGCGCACAAGGTG |