| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.060950 |
| Chromosome: | chromosome 5 |
| Location: | 3046112 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g232004 | (1 of 1) IPR012677//IPR014720 - Nucleotide-binding alpha-beta plait domain // Double-stranded RNA-binding domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACGGTCGTGCCGCCCTCCAGCAGATGCAGCACACACTGGAAGGGGGCG |
| Internal bar code: | ATAGTACCGACTATACACTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 461 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTTCCGACCCAAAACGTG |
| Suggested primer 2: | ACCTGAAGGCTTGAAGACCG |