Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.060957 |
Chromosome: | chromosome 9 |
Location: | 4108279 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g399252 | 3'UTR | ||
Cre09.g399289 | (1 of 3) PF00651//PF03110 - BTB/POZ domain (BTB) // SBP domain (SBP) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTTGATGCCCGGCGGGGATGGGGGGGGGTGGGGGATGCGCATCTGGCG |
Internal bar code: | GGTTTTTGAAAATTTGGGTCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1424 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCAATGAGGGCAAACGTTT |
Suggested primer 2: | ACATACAGGCTATGCTCCGC |