| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.061094 |
| Chromosome: | chromosome 1 |
| Location: | 4304993 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029200 | DIV30,ESP1 | Separase, cell cycle protease; (1 of 1) 3.4.22.49 - Separase / Separin | outside_mRNA |
| Cre01.g029250 | AAH1 | Aromatic amino acid hydroxylase-related protein; (1 of 1) PF00351 - Biopterin-dependent aromatic amino acid hydroxylase (Biopterin_H) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCACCGTCTGTCCAGGGGTCTGTCACACCTGGCCACGCCTGTGACAGCA |
| Internal bar code: | TGTGTGCATAGAACTTAGCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1392 |
| LEAP-Seq percent confirming: | 41.1765 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTTCTTGTGGCTTTGTGC |
| Suggested primer 2: | GGTTTCGGGTTCTGCGTTTC |