Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.061115 |
Chromosome: | chromosome 10 |
Location: | 3932350 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g446700 | ANK28 | (1 of 2) PTHR24161:SF17 - PALMITOYLTRANSFERASE; Predicted protein with ankyrin repeats | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAACACAAACTTCCGATTTCGGTCCGTGCTCCTGAAGCTTACGTCTCTT |
Internal bar code: | ACACCAATGCTTGTGGGCCCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4388 |
LEAP-Seq percent confirming: | 78.5714 |
LEAP-Seq n confirming: | 88 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 112 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAATCGCGCCTATAGAGCCC |
Suggested primer 2: | CGTTGTCAGGACTGTCCACA |