| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.061146 |
| Chromosome: | chromosome 12 |
| Location: | 697157 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g492900 | (1 of 3) PF01661 - Macro domain (Macro) | outside_mRNA | |
| Cre12.g492950 | NSG5,DIV15,RIR1 | (1 of 1) K10807 - ribonucleoside-diphosphate reductase subunit M1 (RRM1); Ribonucleoside-diphosphate reductase R1 subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACAATGCCCACAATGCATGGGCTGCACACCGCTCACACCGTCCTCTTC |
| Internal bar code: | GGAATGCGACGCGGTTACGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4214 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 86 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGCGGGTGGTCTTTTTC |
| Suggested primer 2: | AACGGTGGACTGTGGGTTTT |