| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.061150 |
| Chromosome: | chromosome 3 |
| Location: | 1152591 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g149150 | (1 of 1) IPR000104//IPR013022 - Antifreeze protein, type I // Xylose isomerase-like, TIM barrel domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCGGTGCACGTTCTCAAGACATTTCGCTGCACCAACCCAAAACGGCA |
| Internal bar code: | AGTGGGATGATTAAGTCTGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 966 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGCAAACAGCTCATCATCG |
| Suggested primer 2: | GAAGGAGATGCGCGAGATGA |