| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061206 |
| Chromosome: | chromosome 5 |
| Location: | 362951 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243472 | (1 of 2) IPR013321 - Arc-type ribbon-helix-helix | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACGAAACTGAAAACCGCACGACGCATAAAGACGAAGATATCGCTTTTG |
| Internal bar code: | TTCAGACACCTAATAACCCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4228 |
| LEAP-Seq percent confirming: | 38.8889 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGGGTATGGGGTGTTTTA |
| Suggested primer 2: | CTGGGACATATCAGACCGGC |