Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.061211 |
Chromosome: | chromosome 12 |
Location: | 5571880 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g530950 | TGL18 | (1 of 5) PF01734 - Patatin-like phospholipase (Patatin); Putative triacylglycerol lipase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCGCAATGTGTTTCACGTGGGTGTACCAATGTCAGTAAGCATACGCT |
Internal bar code: | GTAGGTGCCAGGTATAACGTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5278 |
LEAP-Seq percent confirming: | 55.2381 |
LEAP-Seq n confirming: | 58 |
LEAP-Seq n nonconfirming: | 47 |
LEAP-Seq n unique pos: | 105 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGCCCCGCCTATAATCAGC |
Suggested primer 2: | CCTGTAGCTGCTCCGAGATG |