| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061295 |
| Chromosome: | chromosome 3 |
| Location: | 5243550 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182100 | IPK,ITPK1 | (1 of 1) 2.7.1.134 - Inositol-tetrakisphosphate 1-kinase / Inositol-trisphosphate 6-kinase; Inositol 1%252C3%252C4-trisphosphate 5/6-kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGTTTTAAGAGGGAACAATCTGACTGTGCCAGAGTGTGAACTTGGATT |
| Internal bar code: | AGGTTGGCTTTAATATTGTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4552 |
| LEAP-Seq percent confirming: | 99.3377 |
| LEAP-Seq n confirming: | 150 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 151 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATTCGGACCCCAACCTTC |
| Suggested primer 2: | CACCTTCGACAGCCTCAAGT |