| Insertion cassette: | CIB2 | 
| Side of cassette: | 3' truncated? | 
| Strand: | - | 
| Strain: | CLIP2.061301 | 
| Chromosome: | chromosome 9 | 
| Location: | 1794595 | 
| Confidence (%): | 80 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre09.g398050 | (1 of 30) PF13450 - NAD(P)-binding Rossmann-like domain (NAD_binding_8) | 3'UTR | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGGAACTACGGTAGTGCCGAAATGGCAACATGATTGAACTTGACCAG | 
| Internal bar code: | CCGAGAACAATGGTTCGAAGTC | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3364 | 
| LEAP-Seq percent confirming: | 97.7778 | 
| LEAP-Seq n confirming: | 44 | 
| LEAP-Seq n nonconfirming: | 1 | 
| LEAP-Seq n unique pos: | 45 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATATTCAGGGCCCGAGAGC | 
| Suggested primer 2: | TTTGCAGGCCATGACAAACG |