| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.061315 |
| Chromosome: | chromosome 12 |
| Location: | 5426432 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529500 | RRM11 | (1 of 1) 2.1.1.167 - 27S pre-rRNA (guanosine(2922)-2'-O)-methyltransferase; Putative ribosomal RNA methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAAAGCACAGGGCAACGAACATGCATGGCGGCTGTGACATAGCACTG |
| Internal bar code: | GGCTGTGTCGTTGTGGGCGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1887 |
| LEAP-Seq percent confirming: | 98.2143 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTGTTGCAGCTGTGGGTC |
| Suggested primer 2: | ATGTGCTTGAGCCCTGACTC |