Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.061367 |
Chromosome: | chromosome 16 |
Location: | 1307254 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g651500 | (1 of 1) K12180 - COP9 signalosome complex subunit 7 (COPS7, CSN7) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACATAAACATTTATGCCCGCGCCAATAGAATTGCCCATAAGCTTGAAC |
Internal bar code: | GGATGCCCGTGTCAAAAAGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1173 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 37 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGCGAAACTCACCTCCTT |
Suggested primer 2: | CGTCAATACCGCCAGCAATG |