| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.061385 |
| Chromosome: | chromosome 2 |
| Location: | 1962015 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g087950 | TSM1 | Methionyl-tRNA synthetase; (1 of 1) PTHR11946:SF86 - METHIONINE--TRNA LIGASE, CYTOPLASMIC | outside_mRNA |
| Cre02.g088000 | POC17,PHB1 | Proteome of centriole protein 17; (1 of 1) K17081 - prohibitin 2 (PHB2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCAACAATAGCAAGCCAGCTCTAGTTAATTATTTTACCCACACAACCA |
| Internal bar code: | GGAATTTAGATGGGAAATAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 605 |
| LEAP-Seq percent confirming: | 58.9744 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCTCCACAACACACCTC |
| Suggested primer 2: | ATCTGCAGGTCCTTGCTTCC |