| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.061394 |
| Chromosome: | chromosome 6 |
| Location: | 89733 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g249500 | MET1,DMC7,DMT1B,DMT1 | (1 of 4) K00558 - DNA (cytosine-5)-methyltransferase 1 (DNMT1, dcm); Cytosine-C5 specific DNA methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGCCACGGGCGGCCAGCGCAGTGACCTAGGTGCATGCAGTGGCAACGC |
| Internal bar code: | ACCATGTGATTGGAGTTTTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3457 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCTCACAACACCGCCTCT |
| Suggested primer 2: | CTTGGCAGTTTGGAACCAGC |