| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.061402 |
| Chromosome: | chromosome 1 |
| Location: | 6693244 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g047750 | RPL18a,RPL18A | (1 of 1) K02882 - large subunit ribosomal protein L18Ae (RP-L18Ae, RPL18A); Cytosolic 80S ribosomal protein L18a | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTTTGGCCACCAGCAGCAGCCACCGCCCCGCTCCCAGCGACAGCCGGC |
| Internal bar code: | GCCAGGACTTTCTTGAGTGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3391 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCAAGCAGTTCCACAACG |
| Suggested primer 2: | GTCCAGTACCCGTTGCAAGA |